Sierra Acai Company
Sierra Acai Company
Open 7 Days a Week
MonaVie Independent Distributor
Distributor Training
Shop Online
Enroll Now
Buy Wholesale and maintain an Active status for 2 months and we will refund your $39 Distributor Fee
Friends
Buy Wholesale and maintain an Active status for 2 months and we will refund your $39 Distributor Fee
20-September-2008 09:29:09 - Guide RNA Guide RNA is the RNA that guides the insertion of uridines into mRNAs in trypanosomes in a process known as RNA ing. These are encoded at distant regions of the kinetoplast genome. The 5' end of a gRNA hybridizes to a short region of an uned pre-mRNA, called an anchor sequence, while its 3' end functions as a template for the ing process. Many gRNAs do not hybridize to anchor sequences in the primary transcript, but rather to sequences in partially ed intermediates. Thus ing of a trypanosome pre-mRNA generally starts near the 3' end and progresses towards the 5' end in a repetitive process that requires several different gRNAs, which bind sequentially to anchor sequences in previously ed sections.molecular cell biology lodish et al. 2004 It is not clear why trypanosome kinetoplasts utilize such an elaborate mechanism to produce mRNAs. The finding that RNA ing is most extensive in the earliest trypanosomes to have evolved suggests that this process may be a molecular fossil of the mechanism of RNA synthesis during an early stage in the evolution of modern cells.citation needed Overview of gRNA-mediated ing The mitochondria for some trypanosome protozoa undergo gRNA-mediated mRNA ing. The gRNA identifies particular sequences and inserts or deletes Uridine U nucleotides. The ed portion of the mRNA is in the coding region, which has the effect of modifying the protein that is produced. Example of gRNA-mediated ing In the protozoan, Leishmania tarentolae, some mitochondrial genes are ed using this process. One such gene is Cyb.1 While the exact sequence of events is still under study, one model has that the mRNA is actually ed twice in succession. For the first , the relevant sequence on the mRNA is mRNA 5' AAAGAAAAGGCUUUAACUUCAGGUUGU 3' The 3' end is used to anchor the gRNA gCyb-I gRNA in this case with normal basepairing some G/U pairs are used. The 5' end does not exactly match and an endonuclease makes cuts in the mRNA to allow for alignment. gRNA 3' AAUAAUAAAUUUUUAAAUAUAAUAGAAAAUUGAAGUUCAGUA 5' mRNA 5' A A AGAAA A G G C UUUAACUUCAGGUUGU 3' The mRNA is now repaired by adding U, giving the sequence gRNA 3' AAUAAUAAAUUUUUAAAUAUAAUAGAAAAUUGAAGUUCAGUA 5' mRNA 5' UUAUUAUUUAGAAAUUUAUGUUGUCUUUUAACUUCAGGUUGU 3' This particular gene has two overlapping gRNA ing sites. The 5' end of this section is the 3' anchor for another gRNA gCyb-II gRNA. Notes ^ See 1 Accessed 19 May 2006 for details. v d e Types of nucleic acids Constituents Nucleobases | Nucleosides | Nucleotides | Deoxynucleotides Ribonucleic acids RNA | mRNA pre-mRNA/hnRNA | tRNA | rRNA | aRNA | gRNA | miRNA | ncRNA | piRNA | shRNA | siRNA | snRNA | snoRNA | stRNA | ta-siRNA | tmRNA Deoxyribonucleic acids DNA | cDNA | gDNA | msDNA | mtDNA Nucleic acid analogues GNA | LNA | PNA | TNA | morpholino Cloning vectors phagemid | plasmid | lambda phage | cosmid | P1 phage | fosmid | BAC | YAC | HAC Major families of biochemicals Saccharides | Carbohydrates | Glycosides | | Amino acids | Peptides | Proteins | Glycoproteins | | Lipids | Terpenes | Steroids | Carotenoids Alkaloids | Nucleobases | Nucleic acids | | Enzyme cofactors | Flavonoids | Polyketides | Tetrapyrroles This genetics article is a stub. This molecular or cell biology article is a stub. This biochemistry article is a stub. Retrieved from http://en..org/wiki/Guide_RNA Categories: Genetics stubs | Molecular and cellular biology stubs | Biochemistry stubsHidden categories: All articles with statements | Articles with statements since October 2007 Views Article Discussion this page History Personal tools Log in / create account Navigation Main page Contents Featured content Current events Random article Search Go Search Interaction Community portal Recent changes Contact Donate to Help Toolbox What links here Related changes Upload file Special pages Printable version Permanent link Cite this page Languages 中文 This page was last modified on 19 June 2008, at 22:13
39 Reasons to Drink Acai Juice Every Day
What is MonaVie - Watch the 8-minute video
Discovering MonaVie video
The Power of You video
Log into your Wholesale MonaVie Account
So many of us do not eat a balanced diet, get enough sleep, have too much stress, or are impacted with toxins and pollutants. Drinking 2 ounces of MonaVie twice a day will help your body detoxify as well as build your immune system. Its the smartest thing you can do for yourself, so start today. Buying MonaVie through our company guarantees you support 7 days a week and, if you would like to share MonaVie with your family and friends we will guide you from start to finish.
1. Click on Enroll Now (30 - 55% off retail price)
2. Pay $39 for your Wholesale ID number.
3. NO minimum order required.
4. MonaVie is delivered to your door in 3 to 5 days.